Targeting A20 Decreases = Glioma Stem Cell Survival and Tumor Growth

Results

A20 Is Highly Expressed in = Glioma Stem=20 Cells

To determine whether A20 = could=20 differentially contribute to glioma biology through the recently=20 identified glioma subfractions, we utilized several complementary = methods=20 to evaluate A20 expression in freshly isolated GSC-enriched and = -depleted=20 cultures derived using our previously published methodology [11],[12],[15],[21],[23],[25]. To determine whether A20 was = differentially expressed at the transcript level, total mRNA was = collected=20 and analyzed by quantitative real-time PCR. We found GSC-enriched = cells=20 isolated from short-term xenografts expressed elevated = A20 mRNA=20 levels in comparison to matched non-stem glioma cells (Figure 1A

).=20 We had previously confirmed that these cells self-renew and = propagate=20 tumors in an immunocompromised host [11],[12],[21],[23]. As in our past studies, the = GSCs also=20 express high levels of the glioma stem cell marker encoded by=20 Olig2 (Figure 1B

).=20 Consistent with these results, GSCs isolated directly from patient = specimens also expressed elevated levels of A20 and Olig2 (Figure 1C

).=20 To determine whether elevated A20 mRNA expression = correlated with=20 increased A20 protein levels, we next visualized A20 expression = using=20 immunofluorescence (Figure 1D and 1E

).=20 Increased expression of A20 was observed in GSCs in comparison to = matched=20 non-stem glioma cells (Figure 1D

).=20 GSCs form neurospheres when cultured in serum-free media. When = single=20 neurospheres were sectioned, we determined A20 was coexpressed = with the=20 stem cell transcription factor Sox2 (Figure 1E

).=20 To confirm these results, we enriched or depleted GSCs from either = short-term xenografts or patient tumor specimens and isolated = lysates for=20 immunoblotting (Figure 1F

;=20 Figure S1). In every tumor tested, = GSCs=20 displayed strikingly elevated A20 levels compared to matched = non-stem=20 cells. Similar to results with mRNA, the differential expression = of A20=20 was true whether subfractions were isolated from patient specimens = passaged short term in immunocompromised mice or directly from = patient=20 specimens (Figure 1F

;=20 Figure S1).

To further evaluate = whether cells=20 expressing a GSC marker also highly express A20 at the single-cell = level=20 in a quantitative manner, we performed flow cytometric analysis = with cells=20 double labeled for A20 and CD133. We confirmed that A20 is highly=20 coexpressed with the glioma stem cell marker CD133 (Prominin-1) = when cells=20 were isolated from a patient specimen passaged short term in=20 immunocompromised mice (Figure 2A

)=20 or directly isolated from patient specimens (Figure 2B

;=20 Figure S2A and S2B). When bulk tumor = cells=20 were analyzed for expression of CD133 and A20, greater than 75% of = CD133+=20 cells were also A20+, whereas less than 10% of CD133=E2=88=92 = cells were A20+ (Figure 2C

;=20 Figure S2A and 2SB). The percentage = of CD133+=20 cells is also higher in the A20+ subpopulation: greater than 50% = of A20+=20 cells were CD133+, whereas less than 8% of A20=E2=88=92 cells were = CD133+ (Figure 2D

;=20 Figure S2C and S2D). Coexpression of = CD133 and=20 A20 also occurred when cells were cultured short term in vitro = after=20 enrichment or depletion of GSCs from a xenografted patient = specimen (Figure S2C and S2D). Together, these = data=20 strongly support elevated expression levels of A20 in GSCs.

Figure=20 1

A20 = expression is=20 elevated in glioma stem cells.

Expression of shRNA Directed = against=20 A20 Decreases GSC Growth and Survival

Although our findings = demonstrated=20 A20 was consistently up-regulated in GSCs, no studies to date have = suggested a functional role for A20 in cancer stem cells. As A20 = was=20 linked to cell survival in some reports [53]=E2=80=93[57], we first assessed the = ability of A20=20 to regulate GSC cell growth and apoptosis by targeting = A20=20 expression using lentiviral transduced short hairpin RNAs (shRNAs) = (Sigma=20 Mission shRNA). To control for potential off-target shRNA effects, = two=20 different sequences of shRNA directed against A20 and a=20 nontargeting shRNA were used when cell numbers permitted. = Transduction=20 with A20 shRNA reduced A20 protein levels in GSCs in = comparison=20 to the nontargeting control, but did not alter Olig2 expression = (Figure 3A and 3B

).=20 A20 targeting profoundly impacted GSC growth as = demonstrated by a=20 marked reduction in cell numbers over time (Figure 3C and 3D

).=20 In contrast, A20 knockdown minimally altered the growth = patterns=20 of non-stem glioma cells (Figure S3A and S3B). The = differential=20 dependence of A20 in GSCs and non-stem cells can be further = demonstrated=20 by analysis of the relative effect of A20 shRNA on cell = growth=20 (Figure S3C=E2=80=93S3F). To determine whether the = decreased=20 growth of GSCs with A20 knockdown was associated with = changes in=20 the cell cycle, we performed flow cytometric analysis with DNA = content=20 determination. Cellular entry into S phase was decreased with = A20=20 targeting (Figure 3E

),=20 supporting a role for A20 in proliferation. We also observed an = increase=20 in the percentage of cells in the SubG0 phase of the cell cycle = (Figure 3F

)=20 and a consistent, but relatively modest, 1.1=E2=80=931.3-fold = increase in=20 G₁ phase cell cycle arrest (unpublished data). Thus, = knockdown=20 of A20 inhibits cell growth due in part to decreased=20 proliferation associated with increased cell death and cell-cycle=20 arrest.

Figure=20 2

Flow = cytometry=20 demonstrates A20 colocalizes with a glioma stem cell=20 marker.

As changes in the cell cycle = suggest that A20=20 regulates cell survival, we evaluated apoptosis with complementary = assays.=20 Annexin V assays detect phosphatidylserine expression on the cell = surface,=20 a process that occurs during apoptosis and other forms of cell = death [5],[58]. In GSCs isolated from two = different=20 human glioma xenografts (Figure 4A

)=20 and directly from a patient specimen (Figure 4B

),=20 introduction of A20-directed shRNA increased the = percentage of=20 Annexin V=E2=80=93positive cells when compared to nontargeting = control shRNA.=20 Caspases, including caspase 3 and caspase 7, are cysteine-aspartic = acid=20 proteases that are activated during apoptosis [5],[58]. In GSCs isolated directly = from a=20 patient specimen (Figure 4C

)=20 or from a human patient specimen passaged short term in = immunocompromised=20 mice (Figure 4D

),=20 caspase 3/7 activity normalized to cell number increased with = A20=20 targeting compared to control. Terminal deoxynucleotidyl = transferase dUTP=20 nick end labeling (TUNEL) staining detects DNA fragments that = occur in the=20 last phase of apoptosis [5],[58]. Increased TUNEL staining = was=20 observed in isolated GSCs with knockdown of A20 (Figure 4E

).=20 The potent induction of apoptosis with A20 targeting was=20 restricted to GSCs as minimal effects were observed with decreased = A20=20 expression in matched non-stem glioma cells (Figure = 4B=E2=80=934D

).=20 Together, these data demonstrate that targeting A20 in = GSCs=20 results in increased apoptosis and suggest that A20 is a = prosurvival=20 factor for GSCs.

Figure=20 3

Targeting = A20 decreases glioma stem cell growth.

To evaluate the potential = mechanism=20 for the decreased survival of GSCs with A20 targeting, we = determined activation of p65/RelA, a central component of = NF-=CE=BAB signaling=20 [59]=E2=80=93[63]. Phosphorylation of RelA at = Serine 536=20 is known to enhance the transactivation potential of the = NF-=CE=BAB complex [62],[63]. NF-=CE=BAB signals have = been shown to be=20 elevated in glioma [64], and targeting RelA in glioma = has been=20 shown to decrease cell growth [65]. We found that knockdown of=20 A20 decreased the activating phosphorylation of RelA = without=20 changes in total RelA levels (Figure 4F

).=20 These data suggest that failure to maintain active RelA in GSCs=20 contributes, at least in part, to the decreased growth and = survival of=20 GSCs with A20 knockdown.

Neurosphere Formation Capacity = Is=20 Decreased with A20 Targeting

Cancer stem cells = are=20 functionally defined through their capacity for sustained = self-renewal. As=20 the growth and survival of GSCs was affected by A20 = knockdown, we=20 next examined whether A20 was important for self-renewal. To more=20 definitively evaluate this possibility, we utilized an in vitro = indicator=20 of self-renewal in normal and cancer stem cells: the neurosphere = assay [1]=E2=80=93[9],[66]=E2=80=93[68]. We found that targeting = A20=20 in GSCs decreased neurospheres formation in comparison to cells = transduced=20 with nontargeting control shRNA (Figure 5

).=20 A20 loss decreased the percentage of wells with neurospheres in = both=20 primary (Figure = 5A=E2=80=935C

)=20 and secondary (Figure 5C

)=20 passages. Neurospheres that did form from A20-targeted = GSCs were=20 smaller than those forming from nontargeted GSCs (Figure = 5D=E2=80=935E

),=20 suggesting decreased proliferation. Thus, the formation of = neurospheres is=20 significantly hampered by the loss of A20, indicating a role for = A20 in=20 GSC self-renewal.

Figure=20 4

Targeting = A20 decreases glioma stem cell = survival.

A20 Protects GSCs from = TNF=CE=B1-Induced=20 Apoptosis

According to the = cancer stem=20 cell hypothesis, GSCs and other cancer stem cells are responsible = for=20 tumor maintenance and recurrence after therapy due to the ability = of these=20 cells to survive cellular assaults that would typically result in = cell=20 death [1]=E2=80=93[5]. For example, GSCs have been = shown to=20 preferentially survive radiotherapy [15],[16], chemotherapy [17],[18], treatment with TNF-related=20 apoptosis-inducing ligand (TRAIL) [19], and Fas-induced apoptosis = [20]. These data demonstrate = GSCs are=20 resistant to a wide variety of prodeath signals. Prior studies = suggested=20 that TNF=CE=B1 therapy may be beneficial for the treatment of = glioma due to the=20 ability to promote apoptosis [69], but the sensitivity of cancer = stem=20 cells to this effect has not been determined. As A20 can inhibit=20 TNF-induced apoptosis in some cell types [43],[44],[53]=E2=80=93[57], and A20 levels are elevated = in GSCs,=20 we hypothesized that GSCs are resistant to TNF=CE=B1-induced = apoptosis. We=20 therefore investigated the effect of TNF=CE=B1 on the survival of = GSC-enriched=20 and -depleted cultures. TNF=CE=B1 increased apoptosis in non-stem = glioma cells=20 (Figure 6A and 6B

),=20 consistent with prior results in glioma cell lines [70],[71]. In contrast, GSCs = isolated from=20 multiple human glioma xenografts were resistant to = TNF=CE=B1-induced cell death=20 (Figure 6A and 6B

=20 and unpublished data). To determine the role of A20 in GSC = TNF=CE=B1 apoptotic=20 resistance, GSCs were transduced with either shRNA directed = against=20 A20 or nontargeting shRNA and subsequently treated with = TNF=CE=B1.=20 Consistent with our prior results (Figure 4

),=20 GSC apoptosis was increased with targeting of A20 as = measured=20 with caspase activity (Figure 6C

;=20 Figure S4A). This increase in = apoptosis was=20 significantly enhanced when A20 knockdown cells were = additionally=20 treated with TNF=CE=B1 (Figure 6C

;=20 Figure S4A). To determine whether = the TNF=CE=B1=20 effects could differentially regulate self-renewal in A20 = knockdown cells, we evaluated neurosphere formation in the = presence and=20 absence of A20 targeting and TNF=CE=B1 treatments. We = found that=20 addition of TNF=CE=B1 in the presence of A20 shRNA, but = not=20 nontargeting shRNA, significantly decreased neurosphere formation = (Figure 6D

;=20 Figure S4B). Together, these data = indicate=20 that GSCs are resistant to TNF=CE=B1-induced apoptosis in an = A20-dependent=20 manner and further demonstrate A20 is an important prosurvival = factor in=20 GSCs.

Figure=20 5

A20=20 knockdown decreases neurosphere formation.

Targeting A20 = Increases the=20 Survival of Mice Bearing Human Glioma Xenografts

Our results thus = far determined=20 an important role for A20 in GSC growth, survival, and = self-renewal in=20 vitro, but the ultimate goal of any cancer stem = cell=E2=80=93directed therapy is=20 to provide therapeutic benefit in vivo. We therefore evaluated the = ability=20 of A20 targeting to increase the survival of = immunocompromised=20 mice bearing intracranially implanted human glioma cells. For = initial=20 experiments, we performed an in vivo limiting dilution assay with = GSCs=20 transduced with nontargeting control shRNA or shRNA directed = against=20 A20. Tumor-bearing mice were allowed to survive until the = development of neurologic signs in each animal (including = lethargy,=20 ataxia, paralysis, or seizure) in accordance with Institutional = Animal=20 Care and Use Committee=E2=80=93approved protocols. For all cell = numbers=20 transplanted, the median survival of mice injected with GSCs = derived from=20 either T3359 (Figure 7A

)=20 or TB-08-0118 (Figure 7B

)=20 was increased with A20 knockdown. When 300=E2=80=931,000 = cells were=20 injected, the tumor incidence also decreased when A20 was = targeted (Figure 7A and 7B

).=20 Kaplan-Meier curves further demonstrate significant increases in = survival=20 with introduction of A20 shRNA when T3359 (Figure 7C

)=20 or TB-08-0118 (Figure 7D

)=20 GSCs were injected. Although cells used in the in vivo studies = displayed=20 successful targeting of A20 expression prior to implantation,=20 immunohistochemical analysis of A20 shRNA tumors that = grew out=20 showed that these tumors escaped A20 knockdown (Figure S5). In a separate experiment = with=20 T4105 cells in which all animals were sacrificed simultaneously at = the=20 onset of the first neurologic sign in any animal, infiltrating = glioma=20 cells were observed in animals injected with GSCs infected with=20 nontargeting shRNA, but not A20-targeting shRNA (Figure 7E

).=20 These in vivo data indicate that targeting A20 in GSCs = can=20 increase survival in mouse models of human brain tumors and = suggest A20=20 could be a useful therapeutic target in glioma.

Figure=20 6

A20 = protects GSCs=20 from TNF=CE=B1-induced apoptosis.

A20 Expression Is Elevated in = Human=20 Glioma Patients and Correlates with Poor Survival

Our data in human glioma = patient=20 specimens and xenografts in vitro and in vivo suggested that = elevated A20=20 levels in GSCs are protumorigenic. To extend these results into a = clinical=20 analysis, we utilized two databases: the National Cancer = Institute's=20 Repository for Molecular Brain Neoplasia Data (REMBRANDT) and The = Cancer=20 Genome Atlas (TCGA), which respectively contain information from = multiple=20 brain tumor types or glioblastoma only. Using REMBRANDT, we found = that=20 up-regulation of A20 mRNA 2-fold or greater in all glioma = patients correlated with a significant decrease in survival (Figure 8A

).=20 When the analysis was restricted to Grade II or Grade III = astrocytoma,=20 A20 mRNA up-regulation 2-fold or greater also = significantly=20 correlated with decreased survival (Figure 8B

).=20 However, A20 mRNA up-regulation did not correlate with = survival=20 in glioblastoma patients in either REMBRANDT or TCGA (Figure 8C

=20 and unpublished data). These data demonstrate that elevation of=20 A20 in early clinical stages of glioma correlates with = poor=20 survival, but differences in A20 expression in the bulk = tumor at=20 the time of glioblastoma diagnosis cannot predict survival. As = global gene=20 expression analyses currently available in the public databases = cannot=20 consider the contribution of the GSC subfraction, these data may=20 underestimate the importance of A20 in glioblastoma. However, it = remained=20 possible that an overall elevation of A20 in glioblastoma = patients compared to lower grade astrocytomas contributed to the = poorer=20 survival of glioblastoma patients. To evaluate this possibility, = we=20 compared the median expression intensity of A20 across = tumor=20 types in REMBRANDT. We found elevated levels of A20 in=20 glioblastoma compared to all other types of brain tumors as well = as=20 control (nontumor) tissue (Figure 8D

).=20 As elevated levels of mRNA may reflect an increase in gene copy = number, we=20 sought to determine whether genomic changes in A20 = occurred in=20 glioma patients. Copy number REMBRANDT analysis for A20 = indicated=20 that a 3-fold or greater amplification of the 6q23.3 chromosomal = region=20 correlated with poor survival, although the number of patients in = this=20 group was small (n

=3D

4; Figure 8E

).=20 It is also important to note that, in contrast to lymphoma [46]=E2=80=93[51], inactivating point = mutations in=20 A20 were not identified in recently completed genetic = screens of=20 the glioma genomes [72],[73]. These data further suggest = that A20=20 activity is important for glioma development and biology. Overall, = our=20 data demonstrate that A20 promotes the tumor initiating capacity = of GSCs=20 and strongly suggests that increased A20 expression contributes to = poor=20 glioma patient outcome.

Figure=20 7

Targeting = A20 decreases glioma stem cell tumorigenic = potential and=20 increases the survival of mice bearing intracranial human = glioma=20 xenografts.

Understanding the genetic = and/or=20 protein expression profile of patients in which A20 is elevated = may be=20 important for elucidating the mechanisms through which = A20 is=20 induced or the pathways through which A20-expressing cells = regulate=20 survival. We therefore utilized the TCGA glioblastoma database to = evaluate=20 the presence of common glioblastoma mutations (Figure S6A and S6B) and expression = of TNF=CE=B1=20 signaling mediators (Figure S6C) in patients with = different levels=20 of A20 expression. Tumors with TP53 and = NF1=20 mutations were enriched in tumors with high A20 = expression in=20 comparison to tumors with intermediate or low A20 levels = (Figure S6A and S6B). In contrast, = the=20 percentage of samples with EGFR mutations was lowest in = tumors=20 with high A20 expression (Figure S6A and S6B). Further = evaluation of=20 expression of TNF=CE=B1 signaling mediators in patients with = differential=20 A20 levels demonstrated higher TNF receptor and = RelB=20 mRNA expression in tumors with elevated A20 expression. = These=20 data suggest that A20 expression may be indicative of elevated = TNF=CE=B1 or=20 NF-=CE=BAB signals. As the effects of these two pathways on GSC = pro-tumorigenic=20 behaviors are relatively unknown, more thorough evaluation of = their=20 biologies in the context of cancer stem cells may be=20 warranted.

Discussion

Our appreciation of the = complex=20 interactions between cell types during tumor initiation, = progression, and=20 recurrence continues to grow with our increasing understanding of = cancer=20 biology. Whereas researchers once considered tumors to be masses = of clonal=20 cancer cells, the involvement of immune cells, endothelial cells, = and=20 neighboring fibroblasts to tumor growth is now well recognized [1]. We believe that the = identification of=20 cancer stem cells with a probable concurrent stochastic clonality = builds=20 upon this model to recognize a previously underestimated = contribution of=20 the heterogeneity of tumor cells themselves [1]=E2=80=93[4]. By profiling the molecular = and=20 biological properties of cancer stem cells, we may therefore = identify=20 genes and proteins whose importance in cancer was poorly = recognized. We=20 have now determined that the inhibitor of apoptosis A20 is a = cancer stem=20 cell target. A20 was elevated in GSCs in comparison to non-stem = glioma=20 cells at both the mRNA and protein levels in cells isolated = directly from=20 glioma patient specimens and human glioma xenografts. Targeting=20 A20 expression with shRNA in GSCs significantly impaired = their=20 growth and survival in vitro and increased tumor latency in mice = bearing=20 human glioma xenografts. The importance of A20 to human glioma = patients is=20 further demonstrated by the association of elevated A20 levels = with poor=20 outcome.

Although current methods for = cancer stem cell=20 enrichment from solid cancers have been sufficient to = differentiate tumor=20 subpopulations, prospective identification of cancer stem cells = has=20 limitations that contribute to the controversy surrounding their = existence=20 [1]=E2=80=93[35]. Due to the restricted amount = of tissue=20 often available after pathologic review, it is difficult to = generate=20 enough patient-derived GSCs for the majority of experiments = without=20 culture or amplification as a xenograft. As we believe that=20 microenvironmental conditions within the tumor contribute to GSC=20 maintenance [74], we utilize a xenograft = isolation=20 system to obtain sufficient GSCs, but validated key studies with = direct=20 analysis of patient specimens. Experiments with cells directly = derived=20 from primary glioma specimens would be optimal, but results in = GSCs from=20 xenograft and patient-derived specimens have, thus far, been = similar [11],[15]. Once tissue or xenografts are = obtained,=20 enrichment or depletion of cancer stem cells from the bulk tumor = can be=20 useful to respectively isolate glioma stem cell and non-stem = glioma cell=20 fractions with the stipulation that both GSC and non-stem glioma=20 populations are heterogeneous and unlikely to be mutually = exclusive based=20 on current sorting protocols [1]=E2=80=93[4],[27]. = Fluorescence-activated cell=20 sorting (FACS) sorting to enrich for glioma stem cells has relied = on the=20 presence of the glycosylated form of the cell surface marker CD133 = (Prominin-1): a protein whose role in tumorigenesis and glioma = biology=20 remains unclear [27]. However, CD133 is not = the only=20 marker useful for prospective identification of glioma stem cells, = not all=20 CD133+ cells are GSCs, and CD133 cannot exclusively segregate for=20 tumorigenic potential and self-renewal in all glioma patient = samples and=20 cell lines studied [27]=E2=80=93[33]. The side population = associated with=20 ABCG2 transporter activity has been shown to be an important = segregator=20 for tumorigenic potential in mouse and human gliomas [24]=E2=80=93[33]. In gliomas without CD133 = expression,=20 the carbohydrate antigen SSEA-1/CD15/LeX can enrich for = tumor-initiating=20 cells [32]. CD133 and SSEA-1 separations = are based=20 on the use of antibodies against unspecified carbohydrate modified = epitopes, adding further complexity by suggesting that = posttranslational=20 modifications to cell surface proteins are important for cancer = stem cell=20 biology [27]. These data suggest = that,=20 similar to leukemias, no one cell surface marker will be = sufficient to=20 isolate a homogeneous population of cancer stem cells from solid = tumors.=20 It is therefore enticing to suggest that molecular targets, such = as A20,=20 that are elevated in GSC-enriched fractions may segregate for a = cancer=20 stem cell subpopulation. Validating our findings in a model = without=20 dependence on CD133, we characterized A20 expression in lines with = tumor=20 enrichment in the SSEA-1+ fraction and found increased A20 = expression (Figure S1). These results strongly = suggest=20 that A20 segregates with tumor initiating potential.

Our data with A20 expression = suggest that,=20 regardless of the cell surface markers used for isolation, the=20 tumor-maintaining glioma subfractions may have common = intracellular=20 molecular targets. Determining the direct contribution of A20 (or = cells=20 expressing other identified nuclear targets such as HIF2=CE=B1[11] and Bmi-1 [22]) is limited by our inability = to sort=20 for live A20-positive cells due to its intracellular localization. = However, one recent study was able to utilize an indirect reporter = based=20 method to further elucidate the role of the transcription factor = Oct4 in=20 cancer stem cell biology. When the Oct4 promoter was used to drive = green=20 fluorescent protein (GFP) expression in osteosarcoma cells, = reporter=20 activity could identify tumor-initiating cells [75]. Application of similar = methodologies=20 to other cancer stem cell targets could permit the development of = non-cell=20 surface marker based sorting techniques and lead to further = confirmation=20 of the existence of cancer stem cells.

Although cancer stem cells can be = isolated=20 using different methodologies, a common theme in cancer stem cell = biology=20 is the ability of this tumor subpopulation to survive cellular = assaults=20 and repopulate the tumor. To date, only a few molecular mechanisms = for GSC=20 resistance to apoptotic signals have been identified. GSC = radioresistance=20 is linked to elevated checkpoint activation and DNA repair [15], whereas chemoresistance is = associated=20 with improved drug efflux due to the presence of the ABCG2 = transporter [24]. Resistance to TRAIL-induced = apoptosis=20 in GSCs may be due to reduced levels of caspase 8 [19], and GSCs appear to be less = sensitive=20 to Fas-induced apoptosis due to decreased levels of oligomeric Fas = [20]. Our data now add A20 as = one of this=20 growing list of prosurvival mediators in GSCs. We find that = knockdown of=20 A20 induces apoptosis in GSCs and sensitizes GSCs to = TNF=CE=B1-induced=20 apoptosis in cell culture, although we have not measured apoptosis = specifically in the GSC compartment in vivo. Whether elevated = levels of=20 A20 in GSCs could also regulate other forms of therapeutic = resistance=20 remains to be investigated, but it is interesting to note that=20 A20 was one of a set of genes identified as mediators of=20 resistance to O6-alkylating agents [52]. Cell lines were derived = from primary=20 and recurrent tumors selected for resistance to 1,3-bis=20 (2-chloroethyl)-1-nitrosourea (BCNU) or temozolomide in media with = 20%=20 fetal calf serum [52]. Under this = prodifferentiating=20 condition, down-regulation of A20 and the established pluripotency = gene=20 leukemia inhibitory factor (LIF) were both associated with = chemoresistance=20 [52]. Roles for A20 (our data) = and LIF [34] in GSC self-renewal imply = that=20 elevation of these proteins would be more likely to facilitate = rather than=20 impede GSC mediated chemoresistance. These data reinforce the = notion that=20 the differentiation state of the glioma cells may differentially = impact=20 the mechanisms through which tumor cells survive cellular stresses = (i.e.,=20 conditional essentiality).

Our examination of A20 in the = context of=20 glioma heterogeneity revealed A20 contributes to GSC = protumorigenic=20 behaviors, but recent evidence in the literature suggests a tumor=20 suppressive role for A20 in other cancers. Although we find A20 is = highly=20 expressed in GSCs and point mutations in A20 have not been = identified in=20 glioma [72],[73], A20 deletion and = mutation=20 is prevalent in lymphoma [46]=E2=80=93[51]. A20 knockdown in = GSCs=20 promotes apoptosis and reduces tumorigenic potential in mouse = models of=20 human cancer, but overexpression of A20 in A20-deficient lymphoma = cells=20 produces similar results [46],[47]. Together, these data suggest = that A20=20 may be a tumor suppressor or a tumor enhancer depending on the = cancer=20 type. Many molecular pathways, including the NF-=CE=BAB pathway = which A20 can=20 inhibit, may be either pro- or antitumorigenic depending on the = cellular=20 context and tumor stage [59]. For example, inhibition = of NF-=CE=BAB=20 signals in mouse epidermis resulted in squamous cell carcinomas [76], whereas a similar = transgenic=20 strategy in transformed hepatocytes prevented tumor progression to = hepatocellular carcinoma [77]. A20 may similarly have = differential=20 effects on tumor development or progression depending on the = biological=20 requirements for A20 in specific tissues. Indeed, unique roles for = A20 in=20 lymphoma and glioma tumor biology may be anticipated based on = differences=20 in basal expression between lymphoid tissues and the brain. In the = majority of tissues, including brain, A20 expression is induced by = a=20 variety of stimuli (TNF=CE=B1, lipopolysaccharide, interleukin-1), = but=20 unexpressed or expressed at very low levels under basal conditions = [53]. However, A20 is constitutively = expressed=20 in lymphoid tissues, particularly the thymus and lymph nodes where = A20 is=20 critical for suppression of inflammatory responses mediated by = NF-=CE=BAB [53],[57]. Mutation of A20 = may=20 therefore be more beneficial during the development of lymphoma. = In=20 contrast, our analysis suggests A20 levels increase with brain = tumor=20 grade, suggesting a benefit for A20 elevation in astrocytoma = growth and=20 linking A20 to glioma tumor progression. Thus, the precise = biological and=20 molecular outcomes of targeting A20 in each tumor type = must be=20 further defined, particularly before broadly applying A20-based = therapies=20 for cancer treatment.

Our data implicate A20 as = an=20 important mediator of cancer stem cell biology by demonstrating = that A20=20 is involved in glioma maintenance through the regulation of GSC = growth and=20 survival. The increased survival of mice bearing intracranial = tumors upon=20 A20 targeting, and the decreased survival of glioma = patients with=20 elevated mRNA, both indicate that inhibition of A20 (or its = downstream=20 mediators) may be beneficial for glioma therapy. However, the = increased=20 survival of mice upon A20 restoration to A20-deficient lymphoma = cells=20 demonstrates that targeting A20 may be harmful for other tumor = types. As=20 we do not fully understand the mechanisms that cause A20 to have=20 differential effects on tumor growth and cancer cell behaviors, = further=20 elucidation of A20 molecular and biological signals is=20 warranted.

Materials and Methods

Ethics Statement

Primary human brain = tumor=20 patient specimens were obtained from patients providing informed = consent=20 under protocols approved by the Duke University or Cleveland = Clinic=20 Institutional Review Boards. All animal experiments were performed = in=20 accordance with a Duke University or Cleveland Clinic = Institutional Animal=20 Care and Use Committee=E2=80=93approved protocol.

Isolation and Culture of = Matched GSCs and=20 Non-Stem Glioma Cells

As previously = described [11],[12],[15],[21],[23],[25], matched cultures enriched or = depleted=20 for GSCs were isolated from primary human brain tumor patient = specimens=20 directly or those passaged short term in immunocompromised mice. A = Papain=20 Dissociation System (Worthington Biochemical) was used to = dissociate=20 tumors according to the manufacturer's instructions (detailed = protocol:=20 http://www.worthington-biochem.com/PDS/d= efault.html).=20 Cells were then cultured in Neurobasal medium supplemented with = B27=20 without vitamin A, l-glutamine, = sodium=20 pyruvate (Invitrogen), 10 ng/ml basic fibroblast growth factor = (bFGF), and=20 10 ng/ml epidermal growth factor (EGF) (R&D Systems) for at = least 6 h=20 to recover surface antigens. Cells were then labeled with an=20 allophycocyanin (APC)-conjugated CD133 antibody (Miltenyi Biotec), = and=20 sorted by fluorescence-activated cell sorting (FACS). = Alternatively, cells=20 were separated microbead-conjugated CD133 antibodies and magnetic = columns=20 (Miltenyi Biotec). CD133-positive cells were designated as GSCs = whereas=20 CD133-negative cells were designated as non-stem glioma cells. = Consistent=20 with previously defined methods for GSC and non-GSC cell culture = [10], GSCs were cultured in the=20 earlier-defined medium: matched non-stem glioma cells were = cultured for at=20 least 24 h in 10% serum containing DMEM to allow cell survival. = After=20 recovery, DMEM medium was removed and the cells cultured in = supplemented=20 Neurobasal medium for at least 12 h before experiments were = performed in=20 identical medium. The cancer stem cell nature of the = CD133-positive cells=20 was confirmed by fluorescent in situ hybridization (FISH) = analysis, serial=20 neurosphere assays, and tumor formation assays, but cultures = depleted of=20 cancer stem cells did not self-renew and or initiate tumors = (unpublished=20 data).

Real-Time PCR

Total RNA was prepared = using the=20 RNeasy kit (Qiagen), and reverse transcribed into cDNA using a = SuperScript=20 III First-Strand Synthesis Kit (Invitrogen). To investigate = expression of=20 A20 and Olig2, individual gene primers were = ordered from=20 Integrated DNA technologies and Master Mixes were purchased from=20 SuperArray Bioscience Corporation. mRNA levels were measured using = an=20 ABI-7900 system (Applied Biosystems). Sequences for primer sets = were as=20 follows:

A20: Forward = 5=E2=80=B2-AGT GTT CCC AGG TGG CCT = TAG AAA-3=E2=80=B2;=20 Reverse 5=E2=80=B2-TCT CAG CCA = AGA CGA TGA AGC=20 AGT-3=E2=80=B2. Olig2: Forward 5=E2=80=B2-GGT AAG TGC GCA ATG GTA = AGC TGT-3=E2=80=B2;=20 Reverse 5=E2=80=B2-TAC AAA GCC = CAG TTT GCA ACG=20 CAG-3=E2=80=B2.

Immunofluorescence = Staining

Cells, = neurospheres, or tumor=20 sections were fixed with 4% paraformaldehyde, washed with = Tris-buffered=20 saline, and incubated with polyclonal mouse anti-A20 (Santa Cruz=20 Biotechnology) and goat anti-Sox2 (Santa Cruz Biotechnology) where = indicated. Primary antibodies were incubated for 16 h at 4=C2=B0C = followed by=20 detection with Alexa 488 donkey anti-mouse (Invitrogen) and Alexa = 568=20 donkey anti-rabbit (Invitrogen) secondary antibodies. Nuclei were = stained=20 with Hoechst 33342 (Invitrogen), and slides were mounted using = Fluoromount=20 (Calbiochem). Images were taken with a Leica SP-5 confocal=20 microscope.

Western Blotting and = Antibodies

Equal amounts of = cell lysate=20 were resolved by SDS-PAGE, transferred to polyvinylidene = difluoride=20 membranes (Millipore), and detected using an enhanced = chemiluminescence=20 system (Pierce Biotechnology) with antibodies against A20 (Abcam = or Santa=20 Cruz Biotechnology), Olig2 (R&D Systems), and Tubulin=20 (Sigma).

FACS Analysis for CD133 and A20 = Costaining

Tumors were = dissociated as=20 described earlier and bulk or isolated GSCs, and non-stem glioma = cells=20 were fixed in 4% paraformaldehyde and subjected to FACS analysis. = FACS=20 analysis was performed on a FACS Aria with 100-=C2=B5m nozzle and = low sheath=20 pressure. Human-specific anti-CD133 (293C3) conjugated to = allophycocyanin5=20 (APC) (Miltenyi) was used with anti=E2=80=93A20-PE generated using = the=20 Lightning-Link PE kit (Innova Biosciences) in combination with an = A20=20 antibody (Abcam).

Lentiviral-Mediated shRNA = Targeting

Lentiviral shRNA = clones (Sigma=20 Mission RNAi) targeting A20 and a scrambled nontargeting = control=20 (SHC002) were purchased from Sigma. These vectors were = cotransfected with=20 the packaging vectors psPAX2 and pCI-VSVG (Addgene) or the = ViraPower=20 Lentiviral Expression System packaging mix (Invitrogen) into 293FT = cells=20 by Lipofectamine 2000 (Invitrogen) to produce the virus. = Efficiency of=20 different lentiviral shRNA clones in cells was determined by = Western blot=20 analysis and real-time PCR. The sequence of the shRNAs utilized = for shRNA1=20 (NM_006290.2-635s1c1),=20 shRNA2 (NM_006290.2-2104s1c1),=20 and shNRA3 (NM_006290.2-957s21c1)=20 was as follows: 5=E2=80=B2-CCGGCACTGGAAGAAATACACATATCTCGAGATATGTGTATTTCTTCCAGTGTT= TTTG-3=E2=80=B2=20 and 5=E2=80=B2-CCGGGAAGCTCAGAATCAGAGATTTCTCGAGAAATCTCTGATTCTGAGCTTCTT= TTTG-3=E2=80=B2;=20 and 5=E2=80=B2-GTACCGGGATGAAGGAGAAGCTCTTAAACTCGAGTTTAAGAGCTTCTCCTTCAT= CTTTTTTG-3=E2=80=B2.

Cell Viability Assay

GSCs infected with = lentivirus=20 expressing the indicated shRNAs for 24 h were plated in 96-well = plates at=20 1,000 cells per well. Cell titers were determined after the = indicated=20 number of days after plating using the CellTiter-Glo Luminescent = Cell=20 Viability Assay kit (Promega).

Cell-Cycle Analysis and Annexin = V=20 Staining

GSCs plated in = six-well plates=20 at 100,000 cells per well were infected with lentivirus expressing = the=20 indicated shRNAs for 48 hours. To determine the percentage of = cells in=20 each phase of the cell cycle, cells were fixed with ethanol and = stained=20 with propidium iodide followed by cell-cycle analysis. To detect = apoptotic=20 cells, Annexin V-FITC staining was performed with the Annexin = V-FITC=20 Apoptosis Detection Kit (BD Pharmingen) according to the = manufacturer's=20 instructions. For experiments in which GSCs and matched non-stem = glioma=20 cells were treated with TNF=CE=B1, cells were plated at a density = of 100,000=20 cells per well in a six-well plate and treated for 72 h with 5 = ng/ml=20 TNF=CE=B1.

Caspase 3/7 Assay

GSCs infected with = lentivirus=20 expressing the indicated shRNAs for 24 h were plated at 1,000 = cells per=20 well and caspase 3/7 activity measured with a commercially = available kit=20 (Promega) after an additional 24 h. Relative caspase activity was = then=20 determined by correcting for cell titers determined as indicated = above.=20 When TNF=CE=B1 treatment was combined with shRNA treatments, cells = were=20 infected with lentivirus expressing the indicated shRNAs for 24 h = followed=20 by TNF=CE=B1 treatment for 24 h.

TUNEL Staining

GSCs infected with = lentivirus=20 expressing the indicated shRNAs for 36 h were stained for TUNEL = using an=20 Apo-BrdU-Red In Situ DNA Fragmentation Assay Kit (Biovision) = according to=20 the manufacturer's instructions.

Neurosphere Formation Assay and = Quantification of Neurosphere Volume

GSCs infected with = lentivirus=20 expressing the indicated shRNAs for 24 h were plated in 24-well = plates at=20 10 cells per well and the percentage of wells containing = neurospheres=20 quantified at indicated times. For secondary sphere formation, = neurosphere=20 forming cells from the first plating were trypsinized and plated = at 10=20 cells per well in 24-well plates. Neurospheres were imaged with an = Olympus=20 CK40 digital camera mounted to a light microscope and neurosphere = size was=20 calculated using ImageJ software. When TNF=CE=B1 treatment was = combined with=20 shRNA treatments, cells were infected with lentivirus expressing = the=20 indicated shRNAs for 24 h followed by treatment with 5 ng/ml = TNF=CE=B1=20 treatment.

Intracranial Tumor Assays

Intracranial = transplantation of=20 GSCs into nude mice was performed as described [11],[12],[15],[23],[25] in accordance with a Duke = University or=20 Cleveland Clinic Institutional Animal Care and Use Committee = approved=20 protocol. Briefly, 36 h after lentiviral infection, cells were = counted and=20 the indicated number of live cells implanted into the right = frontal lobes=20 of athymic nude mice. Mice were maintained until the development = of=20 neurological signs.

Statistical Analysis

Significance was = tested by=20 t-test or ANOVA using GraphPad InStat 3.0 software. For = repeated=20 measures ANOVA and in vivo studies where Kaplan-Meier curves and = log-rank=20 analysis were performed, MedCalc software was=20 used.

Supporting=20 Information

Figure S1

A20 is elevated in SSEA-1+ = fractions=20 of human glioma cells where SSEA-1, but not CD133, is informative = for=20 tumorigenic potential. Equal amounts of lysates from the = human=20 glioma cell lines 1228 and 905 sorted for the expression of SSEA-1 = were=20 probed for the expression of A20 by Western blot. =CE=B1-Tubulin = was utilized=20 as a loading control.

(0.06 MB TIF)

Click=20 here for additional data file.^{(56K, =
tif)}

Figure S2

Flow cytometry = demonstrates A20=20 colocalizes with a glioma stem cell marker. (A and B) = Flow=20 cytometry of fixed bulk tumor cells isolated directly from T3832 = (A) or=20 T3946 (B) patient specimens demonstrates significant co-staining = of the=20 glioma stem cell marker CD133 and A20. (C and D) Flow cytometry = analysis=20 of glioma stem cell-enriched (C) and -depleted (D) cultures from a = T4105=20 patient specimen passaged short term in immunocompromised mice=20 demonstrates passage of cells in vitro maintains coexpression of = the=20 glioma stem cell marker CD133 and A20 in glioma stem cells with = reduced=20 CD133 and A20 expression in non-stem glioma cells.

(1.83 MB TIF)

Click=20 here for additional data file.^{(1.7M, =
tif)}

Figure S3

A20 preferentially = decreases the=20 growth of glioma stem cells. Cell growth as measured with = Trypan=20 Blue staining demonstrated that A20 shRNA decreases the = growth of=20 non-stem glioma cells isolated from T4121 (A) or T08-836 cells = (B). An=20 asterisk (*) indicates p<0.01 with ANOVA comparison to = non-targeting shRNA. Matched glioma stem cells with A20 = targeting=20 are shown in Figure 3C and 3D

.=20 When the fold change in cell numbers relative to the average = non-targeting=20 shRNA cell number is calculated for T4121 (C and D) or T08-837 (E = and F)=20 cells, targeting with A20 shRNA1 (C and E) or = A20 shRNA3=20 (D and F) demonstrates significantly greater reductions in cell = number in=20 the glioma stem cell fractions. An asterisk (*) indicates=20 p<0.001 with t-test comparison to non-stem = glioma=20 cells.

(0.47 MB TIF)

Click=20 here for additional data file.^{(461K, =
tif)}

Figure S4

A20 protects GSCs from = TNF=CE=B1-induced=20 apoptosis. GSC enriched cultures isolated from a T4597 = glioma=20 xenograft were infected with non-targeting shRNA or shRNA directed = against=20 A20 and treated with 5 ng/ml TNF=CE=B1. (A) Relative = caspase activity=20 increased with A20 knockdown and was further increased by = TNF=CE=B1=20 treatment. (B) Neurosphere formation decreased with A20 = knockdown=20 and was further decreased by TNF=CE=B1 treatment. An asterisk (*) = indicates=20 p<0.05 with ANOVA comparison to similarly treated = nontargeting=20 control cells. A number sign (#) indicates p<0.05 with = ANOVA=20 comparison of TNF to untreated cells infected with the same = shRNA.

(0.13 MB TIF)

Click=20 here for additional data file.^{(127K, =
tif)}

Figure S5

Tumors resulting from = implantation of=20 A20 knockdown GSCs = express=20 A20. Immunofluorescence of paraffin-embedded sections of = tumors=20 resulting from implantation of GSCs infected with nontargeting = shRNA or=20 A20 shRNA1 demonstrates A20 is expressed in both tumor=20 types.

(0.41 MB TIF)

Click=20 here for additional data file.^{(402K, =
tif)}

Figure S6

Glioblastoma genetic = subsets and=20 expression of A20. (A) Table demonstrating the number of = samples=20 in the TCGA database analyzed as having low, intermediate, or high = A20=20 expression. The number of samples in each group indicated as = having=20 mutations in p53, EGFR, PTEN, or NF1 is also shown. (B) Analysis = of the=20 percentage of patients with mutations in p53, EGFR, PTEN, or NF1 = for the=20 groups have differential A20 expression is shown. The percentage = of=20 patients with p53 or NF1 mutations is increased in the set of = patients=20 with high A20 expression. (C) Some TNF=CE=B1 signaling mediator = mRNAs are=20 elevated in the set of patients with high A20 expression. Analysis = of the=20 expression of multiple TNF receptor and NF-=CE=BAB family members = demonstrated=20 elevated expression was often observed in patient samples with = elevated=20 A20.

(0.51 MB TIF)

Click=20 here for additional data file.^{(499K,=20
tif)}

Acknowledgments

We are thankful to Dr. Albert = Baldwin for=20 helpful discussions. We thank Y. Sun and D. Satterfield for = technical=20 assistance; M. Cook, B. Harvat, C. Shemo, S. O'bryant for = assistance with=20 flow cytometry.

Abbreviations

Figure=20 8

A20 is a = prognostic=20 indicator in glioma patients.


FACS	fluorescence-activated cell sorting

GSC	glioblastoma stem cell

shRNA	short hairpin RNA

Footnotes

The authors have = declared that=20 no competing interests exist.

AH is supported by = a grant from=20 the National Brain Tumor Society. JDL is supported by a grant from = the=20 American Brain Tumor Association. CE is supported by NS063496, an = F30=20 grant from the National Institutes of Health (NIH). Additional = support was=20 provided by the Goldhirsh Foundation; Damon Runyon Cancer Research = Foundation; Brain Tumor Society, the James S. McDonnell = Foundation; and=20 NIH grants NS054276, CA116659,=20 and CA129958=20 (to JR). The funders had no role in study design, data collection = and=20 analysis, decision to publish, or preparation of the=20 manuscript.

References

1. Reya T, Morrison SJ, Clarke MF, = Weissman IL.=20 Stem cells, cancer, and cancer stem cells. Nature. 2001;414:105=E2=80=93111. [PubMed]

2. Park DM, Rich JN. Biology of glioma = cancer=20 stem cells. Mol Cells. = 2009;28:7=E2=80=9312. [PubMed]

3. Rich JN, Eyler CE. Cancer stem cells = in brain=20 tumor biology. Cold Spring Harb = Symp Quant=20 Biol. 2008;73:411=E2=80=93420. [PubMed]

4. Rosen JM, Jordan CT. The increasing = complexity=20 of the cancer stem cell paradigm. Science.=20 2009;324:1670=E2=80=931673. [PubMed]

5. Fulda S, Pervaiz S. Apoptosis = signaling in=20 cancer stem cells. Int J Biochem = Cell Biol.=20 2010;42:31=E2=80=938. = [PubMed]

6. Singh SK, Clarke ID, Terasaki M, = Bonn VE,=20 Hawkins C, et al. Identification of a cancer stem cell in human = brain=20 tumors. Cancer Res. = 2003;63:5821=E2=80=935828. [PubMed]

7. Singh SK, Hawkins C, Clarke ID, = Squire JA,=20 Bayani J, et al. Identification of human brain tumor initiating = cells.=20 Nature. 2004;432:396=E2=80=93401. [PubMed]

8. Hemmati HD, Nakano I, Lazareff JA,=20 Masterman-Smith M, Geschwind DH, et al. Cancerous stem cells can = arise=20 from pediatric brain tumors. Proc = Natl Acad=20 Sci U S A. 2003;100:15178=E2=80=9315183.=20 [PubMed]

9. Galli R, Binda E, Orfanelli U, = Cipelletti B,=20 Gritti A, et al. Isolation and characterization of tumorigenic, = stem-like=20 neural precursors from human glioblastoma. Cancer Res. 2004;64:7011=E2=80=937021. [PubMed]

10. Lee J, Kotliarova S, Kotliarov Y, Li = A, Su Q,=20 et al. Tumor stem cells derived from glioblastomas cultured in = bFGF and=20 EGF more closely mirror the phenotype and genotype of primary = tumors than=20 do serum-cultured cell lines. Cancer Cell.=20 2006;9:391=E2=80=93403. = [PubMed]

11. Li Z, Bao S, Wu Q, Wang H, Eyler C, = et al.=20 Hypoxia-inducible factors regulate tumorigenic capacity of glioma = stem=20 cells. Cancer Cell. = 2009;15:501=E2=80=93513. [PubMed]

12. Bao S, Wu Q, Sathornsumetee S, Hao = Y, Li Z, et=20 al. Stem cell-like glioma cells promote tumor angiogenesis through = vascular endothelial growth factor. Cancer=20 Res. 2006;66:7843=E2=80=937848. [PubMed]

13. Yao XH, Ping YF, Chen JH, Xu CP, = Chen DL, et=20 al. Glioblastoma stem cells produce vascular endothelial growth = factor by=20 activation of a G-protein coupled formylpeptide receptor FPR. = J Pathol. 2008;215:369=E2=80=93376. [PubMed]

14. Oka N, Soeda A, Inagaki A, Onodera = M, Maruyama=20 H, et al. VEGF promotes tumorigenesis and angiogenesis of human=20 glioblastoma stem cells. Biochem = Biophys Res=20 Commun. 2007;360:553=E2=80=93559. [PubMed]

15. Bao S, Wu Q, McLendon RE, Hao Y, Shi = Q, et al.=20 Glioma stem cells promote radioresistance by preferential = activation of=20 the DNA damage response. Nature.=20 2006;444:756=E2=80=93760. [PubMed]

16. Kang MK, Hur BI, Ko MH, Kim CH, Cha = SH, et al.=20 Potential identity of multi-potential cancer stem-like = subpopulation after=20 radiation of cultured brain glioma. BMC=20 Neurosci. 2008;9:15. = [PubMed]

17. Kang MK, Kang SK. Tumorigenesis of=20 chemotherapeutic drug-resistant cancer stem-like cells in brain = glioma.=20 Stem Cells Dev. 2007;16:837=E2=80=93847. [PubMed]

18. Liu G, Yuan X, Zeng Z, Tunici P, Ng = H, et al.=20 Analysis of gene expression and chemoresistance of CD133+ cancer = stem=20 cells in glioblastoma. Mol Cancer. = 2006;5:67. [PubMed]

19. Capper D, Gaiser T, Hartmann C, = Habel A,=20 Mueller W, et al. Stem-cell-like glioma cells are resistant to = TRAIL/Apo2L=20 and exhibit down-regulation of caspase-8 by promoter methylation.=20 Acta Neuropathol. = 2009;117:445=E2=80=93456. [PubMed]

20. Bertrand J, Begaud-Grimaud G, = Bessette B,=20 Verdier M, Battu S, et al. Cancer stem cells from human glioma = cell line=20 are resistant to Fas-induced apoptosis. Int=20 J Oncol. 2009;34:717=E2=80=93727. [PubMed]

21. Bao S, Wu Q, Li Z, Sathornsumetee S, = Wang H,=20 et al. Targeting cancer stem cells through L1CAM suppresses glioma = growth.=20 Cancer Res. 2008;68:6043=E2=80=936048. [PubMed]

22. Abdouh M, Facchino S, Chatoo W, = Balasingam V,=20 Ferreira J, et al. BMI1 sustains human glioblastoma multiforme = stem cell=20 renewal. J Neurosci. = 2009;29:8884=E2=80=938896. [PubMed]

23. Wang J, Wang H, Li Z, Wu Q, Lathia = JD, et al.=20 c-Myc is required for maintenance of glioma cancer stem cells. = PLoS One. 2008;3:e3769. doi: 10.1371/journal.pone.0003769<= /SPAN>.=20 [PubMed]

24. Bleau AM, Hambardzumyan D, Ozawa T, = Fomchenko=20 EI, Huse JT, et al. PTEN/PI3K/Akt pathway regulates the side = population=20 phenotype and ABCG2 activity in glioma tumor stem-like cells. = Cell Stem Cell. 4:226=E2=80=93235. [PubMed]

25. Eyler CE, Foo WC, LaFiura KM, = McLendon RE,=20 Hjelmeland AB, Rich JN. Brain cancer stem cells display = preferential=20 sensitivity to Akt inhibition. Stem Cells.=20 2008;26:3027=E2=80=933036. [PubMed]

26. Gallia GL, Tyler BM, Hann CL, Siu = IM, Giranda=20 VL, et al. Inhibition of Akt inhibits growth of glioblastoma and=20 glioblastoma stem-like cells. Mol = Cancer=20 Ther. 2009;8:386=E2=80=93393. [PubMed]

27. Bidlingmaier S, Zhu X, Liu B. The = utility and=20 limitations of glycosylated human CD133 epitopes in defining = cancer stem=20 cells. J Mol Med. = 2008;86:1025=E2=80=931032. [PubMed]

28. Beier D, Hau P, Proescholdt M, = Lohmeier A,=20 Wischhusen J, et al. CD133(+) and CD133(=E2=88=92) = glioblastoma-derived cancer=20 stem cells show differential growth characteristics and molecular=20 profiles. Cancer Res. = 2007;67:4010=E2=80=934015. [PubMed]

29. Zheng X, Shen G, Yang X, Liu W. Most = C6 cells=20 are cancer stem cells: evidence from clonal and population = analyses.=20 Cancer Res. 2007;67:3691=E2=80=933697. [PubMed]

30. Joo KM, Kim SY, Jin X, Song SY, Kong = DS, et=20 al. Clinical and biological implications of CD133-positive and=20 CD133-negative cells in glioblastomas. Lab=20 Invest. 2008;88:808=E2=80=93815. [PubMed]

31. Wang J, Sakariassen P=C3=98, = Tsinkalovsky O,=20 Immervoll H, B=C3=B8e SO, et al. CD133 negative glioma cells form = tumors in=20 nude rats and give rise to CD133 positive cells. Int J Cancer. 2008;122:761=E2=80=93768. [PubMed]

32. Son MJ, Woolard K, Nam DH, Lee J, = Fine HA.=20 SSEA-1 is an enrichment marker for tumor-initiating cells in human = glioblastoma. Cell Stem Cell.=20 2009;4:440=E2=80=93452. = [PubMed]

33. Persson AI, Weiss WA. The side story = of=20 stem-like glioma cells. Cell Stem = Cell.=20 2009;4:191=E2=80=93192. = [PubMed]

34. Pe=C3=B1uelas S, Anido J, = Prieto-S=C3=A1nchez RM, Folch=20 G, Barba I, et al. TGF-beta increases glioma-initiating cell = self-renewal=20 through the induction of LIF in human glioblastoma. Cancer Cell. 2009;15:315=E2=80=93327. [PubMed]

35. Zhou BB, Zhang H, Samelin M, Geles = KG,=20 Grindley JC, et al. Tumour-initiating cells: challenges and = opportunities=20 for anticancer drug discovery. Nat = Rev Drug=20 Discov. 2009;8:806=E2=80=93823. [PubMed]

36. Central Brain Tumor Registry of the = United=20 States (CBTRUS). Hinsdale (Illinois): Central Brain Tumor Registry = of the=20 United States; 2005. Statistical Report: Primary Brain Tumors in = the=20 United States, 1998=E2=80=932002.

37. Louis DN, Ohgaki H, Wiestler OD, = Cavenee WK,=20 Burger PC, et al. The 2007 WHO classification of tumors of the = central=20 nervous system. Acta Neuropathol.=20 2007;114:97=E2=80=93109. [PubMed]

38. Beyaert R, Heyninck K, Van Huffel S. = A20 and=20 A20-binding proteins as cellular inhibitors of nuclear = factor-kappa=20 B-dependent gene expression and apoptosis. Biochem Pharmacol. 2000;60:1143=E2=80=931151. [PubMed]

39. Heyninck K, Beyaert R. A20 inhibits = NF-kappaB=20 activation by dual ubiquitin-editing functions. Trends Biochem Sci. 2005;30:1=E2=80=934. [PubMed]

40. Codd JD, Salisbury JR, Packham G, = Nicholson=20 LJ. A20 RNA expression is associated with undifferentiated = nasopharyngeal=20 carcinoma and poorly differentiated head and neck squamous cell = carcinoma.=20 J Pathol. 1999;187:549=E2=80=93555. [PubMed]

41. Guo Q, Dong H, Liu X, Wang C, Liu N, = et al.=20 A20 is overexpressed in glioma cells and may serve as a potential=20 therapeutic target. Expert Opin = Ther=20 Targets. 2009;13:733=E2=80=93741. [PubMed]

42. Lerebours F, Vacher S, Andrieu C, = Espie M,=20 Marty M, et al. NF-kappa B genes have a major role in inflammatory = breast=20 cancer. BMC Cancer. = 2008;8:41. [PubMed]

43. Opipari AW, Jr, Hu HM, Yabkowitz R, = Dixit VM.=20 The A20 zinc finger protein protects cells from tumor necrosis = factor=20 cytotoxicity. J Biol Chem. = 1992;267:12424=E2=80=9312427. [PubMed]

44. J=C3=A4=C3=A4ttel=C3=A4 M, Mouritzen = H, Elling F, Bastholm L.=20 A20 zinc finger protein inhibits TNF and IL-1 signaling. = J Immunol. 1996;156:1166=E2=80=931173. [PubMed]

45. Vendrell JA, Ghayad S, Ben-Larbi S, = Dumontet=20 C, Mechti N, et al. A20/TNFAIP3, a new estrogen-regulated gene = that=20 confers tamoxifen resistance in breast cancer cells. Oncogene. 2007;26:4656=E2=80=934667. [PubMed]

46. Compagno M, Lim WK, Grunn A, Nandula = SV,=20 Brahmachary M, et al. Mutations of multiple genes cause = deregulation of=20 NF-kappaB in diffuse large B-cell lymphoma. Nature. 2009;459:717=E2=80=93721. [PubMed]

47. Kato M, Sanada M, Kato I, Sato Y, = Takita J, et=20 al. Frequent inactivation of A20 in B-cell lymphomas. Nature. 2009;459:712=E2=80=93716. [PubMed]

48. Honma K, Tsuzuki S, Nakagawa M, = Tagawa H,=20 Nakamura S, et al. TNFAIP3/A20 functions as a novel tumor = suppressor gene=20 in several subtypes of non-Hodgkin lymphomas. Blood. 2009;114:2467=E2=80=937. [PubMed]

49. Schmitz R, Hansmann ML, Bohle V, = Martin-Subero=20 JI, Hartmann S, et al. TNFAIP3 (A20) is a tumor suppressor gene in = Hodgkin=20 lymphoma and primary mediastinal B cell lymphoma. J Exp Med. 2009;206:981=E2=80=93989. [PubMed]

50. Novak U, Rinaldi A, Kwee I, Nandula = SV,=20 Rancoita PM, et al. The NF-{kappa}B negative regulator TNFAIP3 = (A20) is=20 inactivated by somatic mutations and genomic deletions in marginal = zone=20 lymphomas. Blood. = 2009;113:4918=E2=80=934921. [PubMed]

51. Chanudet E, Ye H, Ferry J, Bacon CM, = Adam P,=20 et al. A20 deletion is associated with copy number gain at the = TNFA/B/C=20 locus and occurs preferentially in translocation-negative MALT = lymphoma of=20 the ocular adnexa and salivary glands. J=20 Pathol. 2009;217:420=E2=80=93430. [PubMed]

52. Bredel M, Bredel C, Juric D, Duran = GE, Yu RX,=20 et al. Tumor necrosis factor-alpha-induced protein 3 as a putative = regulator of nuclear factor-kappaB-mediated resistance to = O6-alkylating=20 agents in human glioblastomas. J = Clin Oncol.=20 2006;24:274=E2=80=93287. [PubMed]

53. Lee EG, Boone DL, Chai S, Libby SL, = Chien M,=20 et al. Failure to regulate TNF-induced NF-kappaB and cell death = responses=20 in A20-deficient mice. Science.=20 2000;289:2350=E2=80=932354. [PubMed]

54. Daniel S, Arvelo MB, Patel VI, Longo = CR,=20 Shrikhande G, et al. A20 protects endothelial cells from TNF-, = Fas-, and=20 NK-mediated cell death by inhibiting caspase 8 activation. = Blood. 2004;104:2376=E2=80=932384. [PubMed]

55. Yu L, Miao H, Hou Y, Zhang B, Guo L. = Neuroprotective effect of A20 on TNF-induced postischemic = apoptosis.=20 Neurochem Res. 2006;31:21=E2=80=9332. [PubMed]

56. Miao HS, Yu LY, Hui GZ, Guo LH. = Antiapoptotic=20 effect both in vivo and in vitro of A20 gene when transfected into = rat=20 hippocampal neurons. Acta = Pharmacol Sin.=20 2005;26:33=E2=80=9338. = [PubMed]

57. Tewari M, Wolf FW, Seldin MF, O'Shea = KS, Dixit=20 VM, et al. Lymphoid expression and regulation of A20, an inhibitor = of=20 programmed cell death. J Immunol.=20 1995;154:1699=E2=80=931706. [PubMed]

58. Muppidi J, Porter M, Siegel RM. = Measurement of=20 apoptosis and other forms of cell death. Curr Protoc Immunol. = Chapter. 2004;3:Unit=20 3.17.

59. Pikarsky E, Ben-Neriah Y. NF-kappaB=20 inhibition: a double-edged sword in cancer? Eur J Cancer. 2006;42:779=E2=80=93784. [PubMed]

60. Yang F, Tang E, Guan K, Wang CY. IKK = beta=20 plays an essential role in the phosphorylation of RelA/p65 on = serine 536=20 induced by lipopolysaccharide. J = Immunol.=20 2003;170:5630=E2=80=935635. [PubMed]

61. Gutierrez H, O'Keeffe GW, = Gavald=C3=A0 N, Gallagher=20 D, Davies AM. Nuclear factor kappa B signaling either stimulates = or=20 inhibits neurite growth depending on the phosphorylation status of = p65/RelA. J Neurosci. = 2008;28:8246=E2=80=938256. [PubMed]

62. Sakurai H, Chiba H, Miyoshi H, = Sugita T,=20 Toriumi W. IkappaB kinases phosphorylate NF-kappaB p65 subunit on = serine=20 536 in the transactivation domain. J Biol=20 Chem. 1999;274:30353=E2=80=9330356. [PubMed]

63. Sasaki CY, Barberi TJ, Ghosh P, = Longo DL.=20 Phosphorylation of RelA/p65 on serine 536 defines an=20 I{kappa}B{alpha}-independent NF-{kappa}B pathway. J Biol Chem. 2005;280:34538=E2=80=9334547. [PubMed]

64. Xie TX, Aldape KD, Gong W, Kanzawa = T, Suki D,=20 et al. Aberrant NF-kappaB activity is critical in focal necrosis = formation=20 of human glioblastoma by regulation of the expression of tissue = factor.=20 Int J Oncol. 2008;33:5=E2=80=9315. [PubMed]

65. Smith D, Shimamura T, Barbera S, = Bejcek BE.=20 NF-kappaB controls growth of glioblastomas/astrocytomas. = Mol Cell Biochem. 2008;307:141=E2=80=93147. [PubMed]

66. Reynolds BA, Weiss S. Generation of = neurons=20 and astrocytes from isolated cells of the adult mammalian central = nervous=20 system. Science. 1992;255:1707=E2=80=931710. [PubMed]

67. Chiasson BJ, Tropepe V, Morshead CM, = van der=20 Kooy D. Adult mammalian forebrain ependymal and subependymal cells = demonstrate proliferative potential, but only subependymal cells = have=20 neural stem cell characteristics. J=20 Neurosci. 1999;19:4462=E2=80=934471.=20 [PubMed]

68. Sanai N, Tramontin AD, = Qui=C3=B1ones-Hinojosa A,=20 Barbaro NM, Gupta N, et al. Unique astrocyte ribbon in adult human = brain=20 contains neural stem cells but lacks chain migration. Nature. 2004;427:740=E2=80=93744. [PubMed]

69. Mora R, Abschuetz A, Kees T, Dokic = I, Joschko=20 N, et al. TNF-alpha- and TRAIL-resistant glioma cells undergo=20 autophagy-dependent cell death induced by activated microglia. = Glia. 2009;57:561=E2=80=93581. [PubMed]

70. Chambaut-Gu=C3=A9rin AM, Costa SL, = Lefran=C3=A7ois T,=20 Fages C, Gauthereau X, et al. Effects of retinoic acid and tumor = necrosis=20 factor alpha on GL-15 glioblastoma cells. Neuroreport. 2000;11:389=E2=80=93393. [PubMed]

71. Wakabayashi T, Yoshida J, Ishiyama = J, Mizuno=20 M. Antitumor activity of recombinant human tumor necrosis = factor-alpha=20 (rH-TNF alpha) and liposome-entrapped rH-TNF alpha. Neurol Med Chir (Tokyo). 1997;37:739=E2=80=93745. [PubMed]

72. The Cancer Genome Atlas Research = Network.=20 Comprehensive genomic characterization defines human glioblastoma = genes=20 and core pathways. Nature. = 2008;455:1061=E2=80=931068. [PubMed]

73. Parsons DW, Jones S, Zhang X, Lin = JC, Leary=20 RJ, et al. An integrated genomic analysis of human glioblastoma=20 multiforme. Science. = 2008;321:1807=E2=80=931812. [PubMed]

74. Heddleston JM, Li Z, McLendon RE, = Hjelmeland=20 AB, Rich JN. The hypoxic microenvironment maintains glioblastoma = stem=20 cells and promotes reprogramming towards a cancer stem cell = phenotype.=20 Cell Cycle. 2009;8:3274=E2=80=933284. [PubMed]

75. Levings P, McGarry S, Currie T, = Nickerson D,=20 McClellan S, et al. Expression of an exogenous human Oct-4 = promoter=20 identifies tumor-initiating cells in osteosarcoma. Cancer Res. 2009;69:5648=E2=80=935655. [PubMed]

76. van Hogerlinden M, Rozell BL, = Ahrlund-Richter=20 L, Toftg=C3=A5rd R. Squamous cell carcinomas and increased = apoptosis in skin=20 with inhibited Rel/nuclear factor-kappaB signaling. Cancer Res. 1999;59:3299=E2=80=933303. [PubMed]

77. Pikarsky E, Porat RM, Stein I, = Abramovitch R,=20 Amit S, et al. NF-kappaB functions as a tumor promoter in=20 inflammation-associated cancer. Nature.=20 2004;431:461=E2=80=93466. [PubMed]

PubMed related articles

Targeting=20 interleukin 6 signaling suppresses glioma stem cell survival and = tumor=20 growth.=20
Stem Cells. 2009 Oct; = 27(10):2393-404.=20

[Stem Cells. 2009]
Targeting=20 cancer stem cells through L1CAM suppresses glioma growth.=20
Cancer Res. 2008 Aug 1; = 68(15):6043-8.=20

[Cancer Res. 2008]
Glioma=20 stem cells are more aggressive in recurrent tumors with = malignant=20 progression than in the primary tumor, and both can be = maintained=20 long-term in vitro.=20
BMC Cancer. 2008 Oct 22; 8:304. = Epub 2008=20 Oct 22.

[BMC Cancer. 2008]
Hypoxia-inducible=20 factors regulate tumorigenic capacity of glioma stem cells.=20
Cancer Cell. 2009 Jun 2; = 15(6):501-13.=20

[Cancer Cell. 2009]
ReviewPresent and potential future = adjuvant=20 issues in high-grade astrocytic glioma treatment.=20
Adv Tech Stand Neurosurg. 2009; = 34:3-35.=20

[Adv Tech Stand Neurosurg. 2009]
=C2=BB See=20 reviews... | =C2=BB See=20 all...

Formats:

PubMed articles by these = authors

PubMed related articles

Recent Activity

Links

Simple NCBI Directory

Getting Started

Resources

Popular

Featured

NCBI Information